View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9542H-LTR4-TNT-insertion-9 (Length: 115)
Name: F9542H-LTR4-TNT-insertion-9
Description: F9542H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9542H-LTR4-TNT-insertion-9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 4e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 10 - 106
Target Start/End: Original strand, 39138194 - 39138290
Alignment:
| Q |
10 |
ctgaattagtgaaaatgtgttgaggttctgttagttgcccaagttgttaaaatgaatgaatattttgtgtgtttactctttatagatagaacaattg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39138194 |
ctgaattagtgaaaatgtgttgaggttctgttagttgcccaagttgttaaaatgaatgaatattttgtgtgtttactctttatagatagaacaattg |
39138290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 39134397 - 39134485
Alignment:
| Q |
18 |
gtgaaaatgtgttgaggttctgttagttgcccaagttgttaaaatgaatgaatattttgtgtgtttactctttatagatagaacaattg |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39134397 |
gtgaaaatgtgttgagcatctgttagttgcccaagttgttaaaatgaatgaatattttgtgtgtttactctttatagatagaacaattg |
39134485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University