View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9630H-LTR4-TNT-insertion-11 (Length: 355)
Name: F9630H-LTR4-TNT-insertion-11
Description: F9630H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9630H-LTR4-TNT-insertion-11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 337; Significance: 0; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 9 - 345
Target Start/End: Complemental strand, 1431438 - 1431102
Alignment:
| Q |
9 |
gataatcctgatcttggaccgttcttgttgaagataacgagagatatgatatcttcgggtgagaatccgaacaaggctctcaattttggtcttagagctt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1431438 |
gataatcctgatcttggaccgttcttgttgaagataacgagagatatgatatcttcgggtgagaatccgaacaaggctctcaattttggtcttagagctt |
1431339 |
T |
|
| Q |
109 |
tgaaatcatttgagatatgtaatgaagatggtaaaccaagtttggaattggtgatgtgtcttcatgtattggccacaatatactgtaatttaggacagta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1431338 |
tgaaatcatttgagatatgtaatgaagatggtaaaccaagtttggaattggtgatgtgtcttcatgtattggccacaatatactgtaatttaggacagta |
1431239 |
T |
|
| Q |
209 |
caacgaggctataccgattctcgagcgttcgatcgaagttcctgtgttagaggatggtcaagatcatgcactagctaagtttgcagggtgtatgcaatta |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1431238 |
caacgaggctataccgattctcgagcgttcgatcgaagttcctgtgttagaggatggtcaagatcatgcactagctaagtttgcagggtgtatgcaatta |
1431139 |
T |
|
| Q |
309 |
ggtgatacttatgcaatgatgggaaatattgagaatt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1431138 |
ggtgatacttatgcaatgatgggaaatattgagaatt |
1431102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 261 - 346
Target Start/End: Original strand, 1250630 - 1250715
Alignment:
| Q |
261 |
gatggtcaagatcatgcactagctaagtttgcagggtgtatgcaattaggtgatacttatgcaatgatgggaaatattgagaattg |
346 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||| || ||||| ||| |||||| |||||||||||||||| |||||||| |
|
|
| T |
1250630 |
gatggtcaagatcatgcacaagctaagtttgcatggtgcgtgaaattacatgacacttatacaatgatgggaaatatcgagaattg |
1250715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 959 times since January 2019
Visitors: 1117