View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9630H-LTR4-TNT-insertion-14 (Length: 228)

Name: F9630H-LTR4-TNT-insertion-14
Description: F9630H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9630H-LTR4-TNT-insertion-14
F9630H-LTR4-TNT-insertion-14
[»] chr7 (1 HSPs)
chr7 (8-218)||(24531321-24531531)
[»] chr5 (1 HSPs)
chr5 (141-189)||(885099-885147)


Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 218
Target Start/End: Original strand, 24531321 - 24531531
Alignment:
8 gaacacatgaaaatcgtaatctatgtcagtcaaaatcatggatataatatgtcttgtaagcacatggcagttagtagctgcaaggataaaattatgcatg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24531321 gaacacatgaaaatcgtaatctatgtcagtcaaaatcatggatataatatgtcttgtaagcacatggcagttagtagctgcaaggataaaattatgcatg 24531420  T
108 gatcagagtttgaatcatagactccccattttcccatatttaaaatgtgtgaaccccgatcactagactacttgactaaaaacaaaaattatggttgcat 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24531421 gatcagagtttgaatcatagactccccattttcccatatttaaaatgtgtgaaccccgatcactagactacttgactaaaaacaaaaattatggttgcat 24531520  T
208 gtgttcaatta 218  Q
    |||||||||||    
24531521 gtgttcaatta 24531531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 141 - 189
Target Start/End: Complemental strand, 885147 - 885099
Alignment:
141 ccatatttaaaatgtgtgaaccccgatcactagactacttgactaaaaa 189  Q
    ||||||||||||||||||| | || | |||||||||||||||| |||||    
885147 ccatatttaaaatgtgtgagctccaaccactagactacttgacaaaaaa 885099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 950 times since January 2019
Visitors: 1117