View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9630H-LTR4-TNT-insertion-14 (Length: 228)
Name: F9630H-LTR4-TNT-insertion-14
Description: F9630H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9630H-LTR4-TNT-insertion-14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 218
Target Start/End: Original strand, 24531321 - 24531531
Alignment:
Q |
8 |
gaacacatgaaaatcgtaatctatgtcagtcaaaatcatggatataatatgtcttgtaagcacatggcagttagtagctgcaaggataaaattatgcatg |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24531321 |
gaacacatgaaaatcgtaatctatgtcagtcaaaatcatggatataatatgtcttgtaagcacatggcagttagtagctgcaaggataaaattatgcatg |
24531420 |
T |
 |
Q |
108 |
gatcagagtttgaatcatagactccccattttcccatatttaaaatgtgtgaaccccgatcactagactacttgactaaaaacaaaaattatggttgcat |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24531421 |
gatcagagtttgaatcatagactccccattttcccatatttaaaatgtgtgaaccccgatcactagactacttgactaaaaacaaaaattatggttgcat |
24531520 |
T |
 |
Q |
208 |
gtgttcaatta |
218 |
Q |
|
|
||||||||||| |
|
|
T |
24531521 |
gtgttcaatta |
24531531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 141 - 189
Target Start/End: Complemental strand, 885147 - 885099
Alignment:
Q |
141 |
ccatatttaaaatgtgtgaaccccgatcactagactacttgactaaaaa |
189 |
Q |
|
|
||||||||||||||||||| | || | |||||||||||||||| ||||| |
|
|
T |
885147 |
ccatatttaaaatgtgtgagctccaaccactagactacttgacaaaaaa |
885099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 950 times since January 2019
Visitors: 1117