View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9630H-LTR4-TNT-insertion-17 (Length: 194)
Name: F9630H-LTR4-TNT-insertion-17
Description: F9630H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9630H-LTR4-TNT-insertion-17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 9 - 99
Target Start/End: Original strand, 42551061 - 42551151
Alignment:
Q |
9 |
attcttggtcgcatgttacttgggtttggaataggatgtgctattcaggtaattaacattattgttatttacttcggatgtttattcataa |
99 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42551061 |
attcttggtcgcatgttacttgggtttggaataggatgtgctattcaggtaattaacattattgttatttacttcggatgtttattcataa |
42551151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University