View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9645H-LTR4-TNT-insertion-4 (Length: 205)
Name: F9645H-LTR4-TNT-insertion-4
Description: F9645H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9645H-LTR4-TNT-insertion-4 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 89 - 198
Target Start/End: Complemental strand, 186226 - 186117
Alignment:
| Q |
89 |
aggggaaacaagcacacttggagagcgcagtacaatggatagttgtatgctgcgttcgggaaggatgaatcgctcccgaaaaggaatctattgattctct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
186226 |
aggggaaacaagcacacttggagagcgcagtacaatggatagttgtatgctgcgttcgggaaggatgaatcgctcccgaaaaggaatctattgattctct |
186127 |
T |
 |
| Q |
189 |
cccaattggt |
198 |
Q |
| |
|
|||||||||| |
|
|
| T |
186126 |
cccaattggt |
186117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 89 - 197
Target Start/End: Original strand, 491284 - 491392
Alignment:
| Q |
89 |
aggggaaacaagcacacttggagagcgcagtacaatggatagttgtatgctgcgttcgggaaggatgaatcgctcccgaaaaggaatctattgattctct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
491284 |
aggggaaacaagcacacttggagagcgcagtacaatggatagttgtatgctgcgttcgggaaggatgaatcgctcccgaaaaggaatctattgattctct |
491383 |
T |
 |
| Q |
189 |
cccaattgg |
197 |
Q |
| |
|
||||||||| |
|
|
| T |
491384 |
cccaattgg |
491392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 109; Significance: 5e-55; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 89 - 197
Target Start/End: Complemental strand, 13222891 - 13222783
Alignment:
| Q |
89 |
aggggaaacaagcacacttggagagcgcagtacaatggatagttgtatgctgcgttcgggaaggatgaatcgctcccgaaaaggaatctattgattctct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13222891 |
aggggaaacaagcacacttggagagcgcagtacaatggatagttgtatgctgcgttcgggaaggatgaatcgctcccgaaaaggaatctattgattctct |
13222792 |
T |
 |
| Q |
189 |
cccaattgg |
197 |
Q |
| |
|
||||||||| |
|
|
| T |
13222791 |
cccaattgg |
13222783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 7 - 73
Target Start/End: Complemental strand, 6939284 - 6939218
Alignment:
| Q |
7 |
aagaagaagtgatcaaaaattgaatgacatgctgccactttgttttcaaatggaattttgtcgaatt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6939284 |
aagaagaagtgatcaaaaattgaatgacatgctgccactttgttttcaaatggaattttgtcgaatt |
6939218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 118 - 197
Target Start/End: Complemental strand, 25811141 - 25811063
Alignment:
| Q |
118 |
gtacaatggatagttgtatgctgcgttcgggaaggatgaatcgctcccgaaaaggaatctattgattctctcccaattgg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||| |||||||||| ||| || |||||||| ||||||| |
|
|
| T |
25811141 |
gtacaatggatagttgtatgctgcgttcgggaatgacgaatcgct-ccgaaaaggattctttttattctctctcaattgg |
25811063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 89 - 197
Target Start/End: Original strand, 34654612 - 34654720
Alignment:
| Q |
89 |
aggggaaacaagcacacttggagagcgcagtacaatggatagttgtatgctgcgttcgggaaggatgaatcgctcccgaaaaggaatctattgattctct |
188 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34654612 |
aggggaaacaagcacacatggagagcgcaatacaatggatagttgtatgctgcgttcgggaaggatgaatcgctcccgaaaaggaatctattgattctct |
34654711 |
T |
 |
| Q |
189 |
cccaattgg |
197 |
Q |
| |
|
||||||||| |
|
|
| T |
34654712 |
cccaattgg |
34654720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 89 - 197
Target Start/End: Original strand, 3856363 - 3856471
Alignment:
| Q |
89 |
aggggaaacaagcacacttggagagcgcagtacaatggatagttgtatgctgcgttcgggaaggatgaatcgctcccgaaaaggaatctattgattctct |
188 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
3856363 |
aggggaaacaagcacacttggagagagcagtacaatggatagttgtatgttgcgttcgggaaggatgaatcgctcccgaataggaatttattgattctct |
3856462 |
T |
 |
| Q |
189 |
cccaattgg |
197 |
Q |
| |
|
|||||||| |
|
|
| T |
3856463 |
tccaattgg |
3856471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 93 - 161
Target Start/End: Original strand, 40519221 - 40519289
Alignment:
| Q |
93 |
gaaacaagcacacttggagagcgcagtacaatggatagttgtatgctgcgttcgggaaggatgaatcgc |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40519221 |
gaaacaagcacacttggagagcgcagtacaatggatagttgtatgctgcgttcgggaaggatgaatcgc |
40519289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 91 - 141
Target Start/End: Complemental strand, 26374908 - 26374858
Alignment:
| Q |
91 |
gggaaacaagcacacttggagagcgcagtacaatggatagttgtatgctgc |
141 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26374908 |
gggaaacaagcacacttggagagcacagtacaatggatagttgtatgctgc |
26374858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University