View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9645H-LTR4-TNT-insertion-5 (Length: 365)
Name: F9645H-LTR4-TNT-insertion-5
Description: F9645H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9645H-LTR4-TNT-insertion-5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 9 - 358
Target Start/End: Complemental strand, 36397723 - 36397374
Alignment:
Q |
9 |
aattcaaacatatatagtgtatgtcactagttgaaggattgtacttgtttcggtactagacaagtatggttgatgccagtgtaatcacggtaccaatatt |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36397723 |
aattcaaacatatatagtgtatgtcactagttgaaggattgtacttgtttcggtactagacaagtatggttgatgccagtgtaatcacggtaccaatatt |
36397624 |
T |
 |
Q |
109 |
attgcaacggcagtgttatacagcaggagagttttcatagtgaattgcattatgaattaatcgttgttgaccaatacactcacgctcttattgaaaaaca |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36397623 |
attgcaacggcagtgttatacagcaggagagttttcatagtgaattgcattatgaattaatcgttgttgaccaatacactcacgctcttattgaaaaaca |
36397524 |
T |
 |
Q |
209 |
ccgtggttatgggatgtaattgtgatcaaactttcaccatgtaacgataaaaagcctacgtgatcacgtcgtgaattttgttttcgttatcttaaacatt |
308 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36397523 |
ccgtggttatgggatgtaattgtgatcaaactttcaccatgtaacgataaaaagcctacgtgatcacgtcgtgaattttgttttcgttatcttaaacatt |
36397424 |
T |
 |
Q |
309 |
accattgttgtataaaccccaaaaatatcttgactctgtgattgcaattg |
358 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36397423 |
accattgttgtataaaccccaaaaatatcttgactctgtgattgcaattg |
36397374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University