View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9659H-LTR4-TNT-insertion-2 (Length: 202)
Name: F9659H-LTR4-TNT-insertion-2
Description: F9659H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9659H-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 122 - 193
Target Start/End: Original strand, 9004096 - 9004167
Alignment:
| Q |
122 |
atggtgatagcatgtggtgatggtggtcttactaattgggtagctttggataggcttgttgcttctcaattg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9004096 |
atggtgatagcatgtggtgatggtggtcttactaattgggtagctttggataggcttgttgcttctcaattg |
9004167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 9003982 - 9004030
Alignment:
| Q |
8 |
gcaattattcaagtagatatggctaatgaaaatgaagggtcattctctg |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9003982 |
gcaattattcaagtagatatggctaatgaaaatgaagggtcattctctg |
9004030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 899 times since January 2019
Visitors: 1113