View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9659H-LTR4-TNT-insertion-4 (Length: 185)
Name: F9659H-LTR4-TNT-insertion-4
Description: F9659H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9659H-LTR4-TNT-insertion-4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 8 - 175
Target Start/End: Original strand, 51378681 - 51378848
Alignment:
| Q |
8 |
ggtatgggggatatggttgaattggaatgattggatgcggaatcaaaagaagttatctgctgtagaaattgtcaatttggtacagactatgtgcgaagag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51378681 |
ggtatgggggatatggttgaattggaatgattggatgcggaatcaaaagaagttatctgctgtagaaattgtcaatttggtacagactatgtgcgaagag |
51378780 |
T |
 |
| Q |
108 |
tggaaggcagttcagaactatgcagagaatggtatggtatcagatatgatacgtattagctaaaatta |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51378781 |
tggaaggcagttcagaactatgcagagaatggtatggtatcagatatgatacgtattagctaaaatta |
51378848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 82 - 139
Target Start/End: Complemental strand, 51790964 - 51790906
Alignment:
| Q |
82 |
atttggtacagactatgtgcgaagagtggaagg-cagttcagaactatgcagagaatgg |
139 |
Q |
| |
|
|||| |||||||| ||| | ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51790964 |
atttagtacagaccatgcgggaagagtggaagggcagttcagaactatgcagagaatgg |
51790906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University