View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9659H-LTR4-TNT-insertion-5 (Length: 335)
Name: F9659H-LTR4-TNT-insertion-5
Description: F9659H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9659H-LTR4-TNT-insertion-5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 91 - 303
Target Start/End: Complemental strand, 25903958 - 25903746
Alignment:
Q |
91 |
aattcagcaagaaggtgctcagctccgatcgtgtttgagttagttgtatcatcacctaatgtacaaagagcatccgggctagaaagcgaaaactcactgt |
190 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25903958 |
aattcagcaagaaggtgctcagctccgatcgtgtttgagttagttgtatcatcacctaatgtacaaagagcatccgggctagaaagcgaaaactcactgt |
25903859 |
T |
 |
Q |
191 |
tgcttgaagcaatatcagcatcagccaaactaaaatcaccatccaatgaaacatgagatgccgcattacagtcagtgtcagccacaccaaccgaaacacc |
290 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25903858 |
tgcttgaagcaatatcagcatcagccaaactaaaatcaccatccaatgaaacatgagatgccgcattacagtcagtgtcagccacaccaaccgaaacacc |
25903759 |
T |
 |
Q |
291 |
gccaccattcaga |
303 |
Q |
|
|
|||||||| |||| |
|
|
T |
25903758 |
gccaccatccaga |
25903746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 11910485 - 11910418
Alignment:
Q |
8 |
gttcttgcgggccattcctacgatttcaggatcgtattgcaatgtatctttcgaaactgtacctcgca |
75 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11910485 |
gttcttgcgggccattcctacgatttcaggatcgtattgcaatgtatctttcgaaactgtacctcgca |
11910418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University