View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-65 (Length: 185)
Name: J5-65
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5-65 |
 | |
|
| [»] chr8 (4 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 4e-52; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 4e-52
Query Start/End: Original strand, 82 - 185
Target Start/End: Complemental strand, 39625234 - 39625131
Alignment:
| Q |
82 |
tcaattgaccctttctttattcgctttcttcaagatcttcaaaagcgtgttcttctttctaataatattcaagtgcccatgcgggggagcgatgacgttg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39625234 |
tcaattgaccctttctttattcgctttcttcaagatcttcaaaagcgtgttcttctttctaataatattcaagtgcccatgcgggggagcgatgacgttg |
39625135 |
T |
|
| Q |
182 |
atag |
185 |
Q |
| |
|
|||| |
|
|
| T |
39625134 |
atag |
39625131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 104; E-Value: 4e-52
Query Start/End: Original strand, 82 - 185
Target Start/End: Complemental strand, 39634784 - 39634681
Alignment:
| Q |
82 |
tcaattgaccctttctttattcgctttcttcaagatcttcaaaagcgtgttcttctttctaataatattcaagtgcccatgcgggggagcgatgacgttg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39634784 |
tcaattgaccctttctttattcgctttcttcaagatcttcaaaagcgtgttcttctttctaataatattcaagtgcccatgcgggggagcgatgacgttg |
39634685 |
T |
|
| Q |
182 |
atag |
185 |
Q |
| |
|
|||| |
|
|
| T |
39634684 |
atag |
39634681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 39625135 - 39625048
Alignment:
| Q |
1 |
gatagtcattgtgaagtcaaacctttgttggaggagttgttgccatcggtgcagagtcctactcattttccaaataatgaatcaattg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39625135 |
gatagtcattgtgaagtcaaacctttgttggaggagttgttgccatcggtgcagagtcctactcattttccaaataatgaatcaattg |
39625048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 39634685 - 39634598
Alignment:
| Q |
1 |
gatagtcattgtgaagtcaaacctttgttggaggagttgttgccatcggtgcagagtcctactcattttccaaataatgaatcaattg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39634685 |
gatagtcattgtgaagtcaaacctttgttggaggagttgttgccatcggtgcagagtcctactcattttccaaataatgaatcaattg |
39634598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University