View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-7-16 (Length: 302)
Name: J5-7-16
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5-7-16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 41738576 - 41738311
Alignment:
| Q |
1 |
gctacactacagtctaagccactgattaccatttatgaagttaatgtccaagaaaggctttgcttctccatagctgaattgttttgaccaaggcaccctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41738576 |
gctacactacagtctaagccactgattaccatttatgaagttaatgtccaagaaaggctttgcttctccatagctgaattgttttgaccaaggcaccctc |
41738477 |
T |
 |
| Q |
101 |
ttttttatatttgctcctattccatggcacttaaattcaccaaacactgcagtcctgaaacaccaaatgcttataaaatgtcaaatcaaatgtagaacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41738476 |
ttttttatatttgctcctattccatggcacttaaattcaccaaacactgcagtcctgaaacaccaaatgcttataaaatgtcaaatcaaatgtagaacaa |
41738377 |
T |
 |
| Q |
201 |
actatgaagcattgacgcagacaccgatactgctcacgacactaacatgtcgtcaccagaattaat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41738376 |
actatgaagcattgacgcagacaccgatactgctcacgacactaacatgtcgtcaccagaattaat |
41738311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 260 - 302
Target Start/End: Complemental strand, 41738614 - 41738572
Alignment:
| Q |
260 |
aattaatgaagtaatatatgtcatttgattggtgcattgctac |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41738614 |
aattaatgaagtaatatatgtcatttgattggtgcattgctac |
41738572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University