View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_11_82 (Length: 316)
Name: J5_11_82
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5_11_82 |
![](./plan/images/spacer.gif) | ![J5_11_82](./plan/images/spacer.gif) |
|
[»] chr2 (1 HSPs) |
![](./plan/images/spacer.gif) | ![chr2 (10-316)||(8003086-8003392)](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 10 - 316
Target Start/End: Complemental strand, 8003392 - 8003086
Alignment:
Q |
10 |
caattgtggtccttgcacttcgtcatgttataagttacgtattcaccgaacgtgaaactgttgcaaatgcagtatcagatttgtgtccatacttggctgt |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8003392 |
caattgtggtccttgcacttcgtcatgttataagttacgtattcaccgaaggtgaaactgttgcaaatgcagtatcagatttgtgtccatacttggctgt |
8003293 |
T |
![](./plan/images/spacer.gif) |
Q |
110 |
cactctaattcttaatgggatccaaccagtgctttcaggtatacaaatataagagtaagaattttctcaatgaaaagagaaaatagttaaatgttatatt |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8003292 |
cactctaattcttaatgggatccaaccagtgctttcaggtatacaaatataagagtaagaattttctcaatgaaaagagaaaatagttaaatgttatatt |
8003193 |
T |
![](./plan/images/spacer.gif) |
Q |
210 |
attattttaaaaataaaaagatatgacaatattcactataacattttcgtcgtatgctaatgaaaaccaaatattatgaaaagttgtggaaaaatactga |
309 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8003192 |
attattttaaaaataaaaagatatgacaatattcactataacattttcgtcgtatgctaatgaaaaccaaatattatgaaaagttgtggaaaaatactga |
8003093 |
T |
![](./plan/images/spacer.gif) |
Q |
310 |
tgaagta |
316 |
Q |
|
|
||||||| |
|
|
T |
8003092 |
tgaagta |
8003086 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15141 times since January 2019
Visitors: 1162