View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_17_87 (Length: 116)
Name: J5_17_87
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5_17_87 |
![](./plan/images/spacer.gif) | ![J5_17_87](./plan/images/spacer.gif) |
|
[»] chr4 (2 HSPs) |
![](./plan/images/spacer.gif) | ![chr4 (25-116)||(52068523-52068614)](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 1e-41; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 25 - 116
Target Start/End: Original strand, 52068523 - 52068614
Alignment:
Q |
25 |
tgaattnccatcaacttctactgacaccaaatattttntagaatatactttggggatgatagattgatacgtatatctgtaaaagtgaacat |
116 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52068523 |
tgaattcccatcaacttctactgacaccaaatattttttagaatatactttggggatgatagattgatacgtatatctgtaaaagtgaacat |
52068614 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 52068610 - 52068639
Alignment:
Q |
1 |
aacatgatcttattattggtatgatgaatt |
30 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
52068610 |
aacatgatcttattattggtatgatgaatt |
52068639 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6433 times since January 2019
Visitors: 1273