View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_4_11 (Length: 191)
Name: J5_4_11
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_4_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 28791851 - 28791736
Alignment:
| Q |
1 |
aatttaaccttataatgtatgatgtaatggtttaatcattttacctaatgcaaaaaatgttctatgcctgttcttgaaaaccaatatcagagtaatggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28791851 |
aatttaaccttataatgtatgatgtaatggtttaatcattttacctaatgcaaaaaatgttctatgcctgttcttgaaaaccaatatcagagtaatggat |
28791752 |
T |
 |
| Q |
101 |
tggtactcttattaat |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28791751 |
tggtactcttattaat |
28791736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 111 - 191
Target Start/End: Complemental strand, 28791927 - 28791847
Alignment:
| Q |
111 |
attaattttcatcacttcttccaaagcatcgaaccattgtaagtttcagtctcaaaactttcttcttgaacactggaattt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28791927 |
attaattttcatcacttcttccaaagcatcgaaccattgtaagtttcagtctcaaaactttcttcttgaacactggaattt |
28791847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University