View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_4_65 (Length: 485)
Name: J5_4_65
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5_4_65 |
![](./plan/images/spacer.gif) | ![J5_4_65](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-153
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 4032661 - 4032935
Alignment:
Q |
1 |
agctggacaagagtatcgagttccgaccaaactccggtcggaacctcaccggagaatttgttccttgctaaaataagcctctgaagctgcctacatttct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4032661 |
agctggacaagagtatcgagttccgaccaaactccggtcggaacctcaccggagaatttgttccttgctaaaataagcctctgaagctgcctacatttct |
4032760 |
T |
![](./plan/images/spacer.gif) |
Q |
101 |
ggatatcattcggaatatcaccagagaaagaattatcggagaggtcgagattctggagtcgtggaacggtgcagacagaagccggaaacggaccggagag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4032761 |
ggatatcattcggaatatcaccagagaaagaattatcggagaggtcgagattctggagtcgtggaacggtgcagacagaagccggaaacggaccggagag |
4032860 |
T |
![](./plan/images/spacer.gif) |
Q |
201 |
attattccggtgaagaaaaatactatgaagtgcagtagcattaaacaactgaaccggaacaacaccatagaattc |
275 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4032861 |
attattccggtgaagaaaaatactatgaagtgcagtagcattaaacaactgaaccggaacaacaccatagaattc |
4032935 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 160; Significance: 5e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 270 - 432
Target Start/End: Complemental strand, 14879345 - 14879183
Alignment:
Q |
270 |
gaattccttcttgttttctcagatgtttgtttgaacaagttgttgactaatctttgaaccctttgagaaatgttgtaattctagaaagatatgtagattt |
369 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14879345 |
gaattccttcttgttttctcagatgtttgtttgaacaagttgttgactaatctttgaaccctttgagaaatgttgtaattctagaaagatatgtagattt |
14879246 |
T |
![](./plan/images/spacer.gif) |
Q |
370 |
ctttgccacttgtgttttcagatcataatttggaaaattcttaacacttgnatgtctttgctc |
432 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
14879245 |
ctttgccacttgtgttttcagatcataatttggaaaattcttaacacttgtatgtctttgctc |
14879183 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15451 times since January 2019
Visitors: 1166