View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0013-INSERTION-2 (Length: 268)
Name: NF0013-INSERTION-2
Description: NF0013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0013-INSERTION-2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 6 - 266
Target Start/End: Original strand, 15077149 - 15077404
Alignment:
| Q |
6 |
caatccttgagtttgacattagatgttaccgtttaaatttactacaagtttttgatcaatgtattacgtatttgttatgttggtacttagtaccattcaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15077149 |
caatccttgagtttgacattagatgttaccgtttaaatttactacaagtttttgatcaatgtattacgtatta---atgttggtacttagtaccattcaa |
15077245 |
T |
|
| Q |
106 |
acatgatggttgttataacttttctttttggagcatgtattatagta-tttttcactttcacaaaattgacttctaaattgtgatgaaagaattttcttt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15077246 |
acatgatggttgttataacttttctttttggagcatgtattatagtattttttcactttcacaaaattgacttctaaattgtgatgaaagaattttcttt |
15077345 |
T |
|
| Q |
205 |
cgattttgtaactactattattgttcacattatatcattgtttaagtggacctctcactagt |
266 |
Q |
| |
|
|| ||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15077346 |
cgtttttgta---actattattgtttacattatatcattgtttaagtggacctctcactagt |
15077404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 576 times since January 2019
Visitors: 1098