View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0015-INSERTION-6 (Length: 563)
Name: NF0015-INSERTION-6
Description: NF0015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0015-INSERTION-6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 8e-44; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 59 - 229
Target Start/End: Complemental strand, 18331763 - 18331611
Alignment:
Q |
59 |
gattctaagtaaggttattatttgaagaacaatttatgttatccaatgaacctgaaaccagaagtttaaattcaaagatacttagcaagtcatataactt |
158 |
Q |
|
|
||||||| |||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
T |
18331763 |
gattctatgtaaggttattatttgaagaacaattg-tgttatccaatgaagctcaaaccagaagtttaaattcaaagatacttagcaa------------ |
18331677 |
T |
 |
Q |
159 |
tacatgtcaaatttgcatagtatttacaaaatcgtacaagtcagccgattcgagcaagttttgagtacaaa |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18331676 |
-----gtcaaatttgcatagtatttacaaaatcgtacaagtcagccgattcgagcaagttttgagtacaaa |
18331611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 18331852 - 18331793
Alignment:
Q |
1 |
gaaagttactgttaaatcactgtatgaggaatgaagaaattatcgtcttgtgatcaagga |
60 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18331852 |
gaaagttactgttaaatcactgtatgaggaatgaagaaattatcgtcttgtgatcaagga |
18331793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 199 - 305
Target Start/End: Complemental strand, 18329617 - 18329505
Alignment:
Q |
199 |
tcagccgattcgagcaagttttgagtacaaacttcatgcaagtaaat-ga-----tgtttttcatttcaaaatcgttggagtcaggcaactataaccttt |
292 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| | || | |||||||||||||||||||||||||||||| ||| |||| ||| |
|
|
T |
18329617 |
tcagccgattcgagcaagttttgagtacaaacttcatgcaagtagctagaagatttttttttcatttcaaaatcgttggagtcaggccactgtaactttt |
18329518 |
T |
 |
Q |
293 |
gttgcaagtttca |
305 |
Q |
|
|
|||| |||||||| |
|
|
T |
18329517 |
gttgtaagtttca |
18329505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 206 - 263
Target Start/End: Complemental strand, 35186766 - 35186709
Alignment:
Q |
206 |
attcgagcaagttttgagtacaaacttcatgcaagtaaatgatgtttttcatttcaaa |
263 |
Q |
|
|
|||| ||||| ||||||||||||| |||| |||||| |||||||||||||||||||| |
|
|
T |
35186766 |
attctagcaaattttgagtacaaagttcacacaagtagatgatgtttttcatttcaaa |
35186709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 511 times since January 2019
Visitors: 1096