View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0018-INSERTION-1 (Length: 219)

Name: NF0018-INSERTION-1
Description: NF0018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0018-INSERTION-1
NF0018-INSERTION-1
[»] chr4 (1 HSPs)
chr4 (7-219)||(55076612-55076824)
[»] chr6 (1 HSPs)
chr6 (90-219)||(15125312-15125441)
[»] chr1 (1 HSPs)
chr1 (45-127)||(43665606-43665688)


Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 219
Target Start/End: Complemental strand, 55076824 - 55076612
Alignment:
7 agaaacatgttttgagattagcgcaaaagacatcgcaagctttagtttgggtgaaaggaaacatgtgatagagtttgctgaaagagccggcggcataacc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55076824 agaaacatgttttgagattagcgcaaaagacatcgcaagctttagtttgggtgaaaggaaacatgtgatagagtttgctgaaagagccggcggcataacc 55076725  T
107 aaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattcgacggtgatcaccggcagcaaggtcaccaaggaaggcacgacat 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
55076724 aaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattctacggtgatcaccggcagcaaggtcaccaaggaaggcacgacag 55076625  T
207 ggtccttgaagca 219  Q
    |||||||||||||    
55076624 ggtccttgaagca 55076612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 90 - 219
Target Start/End: Original strand, 15125312 - 15125441
Alignment:
90 gagccggcggcataaccaaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattcgacggtgatcaccggcagcaaggtcac 189  Q
    ||||| || ||||||||||||| ||| || ||||||||||| |||||||||||  ||||||| |||||||||||||||||||||||  |||| |||||||    
15125312 gagccagcagcataaccaaggacattaccgacggccatgaaaaaagagaacatcccattgccaattctcattcgacggtgatcaccaccagcgaggtcac 15125411  T
190 caaggaaggcacgacatggtccttgaagca 219  Q
    ||| |||||||||||| |||||||||||||    
15125412 caatgaaggcacgacaaggtccttgaagca 15125441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 127
Target Start/End: Original strand, 43665606 - 43665688
Alignment:
45 gctttagtttgggtgaaaggaaacatgtgatagagtttgctgaaagagccggcggcataaccaaggatatttcccacggccat 127  Q
    ||||| |||| |||||| ||||||| |||| ||||||||||| |||  |||||||| ||||| ||||| || || ||||||||    
43665606 gcttttgttttggtgaacggaaacacgtgaaagagtttgctgtaagcaccggcggcgtaaccgaggatgttaccgacggccat 43665688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University