View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0018-INSERTION-1 (Length: 219)
Name: NF0018-INSERTION-1
Description: NF0018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0018-INSERTION-1 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 219
Target Start/End: Complemental strand, 55076824 - 55076612
Alignment:
| Q |
7 |
agaaacatgttttgagattagcgcaaaagacatcgcaagctttagtttgggtgaaaggaaacatgtgatagagtttgctgaaagagccggcggcataacc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076824 |
agaaacatgttttgagattagcgcaaaagacatcgcaagctttagtttgggtgaaaggaaacatgtgatagagtttgctgaaagagccggcggcataacc |
55076725 |
T |
 |
| Q |
107 |
aaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattcgacggtgatcaccggcagcaaggtcaccaaggaaggcacgacat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076724 |
aaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattctacggtgatcaccggcagcaaggtcaccaaggaaggcacgacag |
55076625 |
T |
 |
| Q |
207 |
ggtccttgaagca |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
55076624 |
ggtccttgaagca |
55076612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 90 - 219
Target Start/End: Original strand, 15125312 - 15125441
Alignment:
| Q |
90 |
gagccggcggcataaccaaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattcgacggtgatcaccggcagcaaggtcac |
189 |
Q |
| |
|
||||| || ||||||||||||| ||| || ||||||||||| ||||||||||| ||||||| ||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
15125312 |
gagccagcagcataaccaaggacattaccgacggccatgaaaaaagagaacatcccattgccaattctcattcgacggtgatcaccaccagcgaggtcac |
15125411 |
T |
 |
| Q |
190 |
caaggaaggcacgacatggtccttgaagca |
219 |
Q |
| |
|
||| |||||||||||| ||||||||||||| |
|
|
| T |
15125412 |
caatgaaggcacgacaaggtccttgaagca |
15125441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 127
Target Start/End: Original strand, 43665606 - 43665688
Alignment:
| Q |
45 |
gctttagtttgggtgaaaggaaacatgtgatagagtttgctgaaagagccggcggcataaccaaggatatttcccacggccat |
127 |
Q |
| |
|
||||| |||| |||||| ||||||| |||| ||||||||||| ||| |||||||| ||||| ||||| || || |||||||| |
|
|
| T |
43665606 |
gcttttgttttggtgaacggaaacacgtgaaagagtttgctgtaagcaccggcggcgtaaccgaggatgttaccgacggccat |
43665688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University