View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0018-INSERTION-2 (Length: 124)
Name: NF0018-INSERTION-2
Description: NF0018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0018-INSERTION-2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 1e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 8 - 121
Target Start/End: Original strand, 42319883 - 42319996
Alignment:
Q |
8 |
attacaacgccccaattcctaaaatcactttgggtctgttttgtttccatcaattttctcattccttgaatatatgctgcaaaaaatatggtttcatttt |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
42319883 |
attacaacgccccaattcctaaaatcactttgggtctgttttgttttcatgaattttctcattccttgaatatatgctgcaaaaaatatggtttgatttt |
42319982 |
T |
 |
Q |
108 |
tatataatattgtt |
121 |
Q |
|
|
|||||||| ||||| |
|
|
T |
42319983 |
tatataattttgtt |
42319996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University