View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0018-INSERTION-5 (Length: 688)
Name: NF0018-INSERTION-5
Description: NF0018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0018-INSERTION-5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 443 - 686
Target Start/End: Original strand, 2298742 - 2298986
Alignment:
| Q |
443 |
ttaattggttatgtgactttggacgctgttatctctagaaaagtatagatatgtttctatttgtgtttccatctatggactgaagttttgatcaagataa |
542 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2298742 |
ttaatcggttatgtgactttggacgctgttatctctagaaaagtatagatatgtttctatttgtgtttccatctatggactgaagttttgatcaagataa |
2298841 |
T |
|
| Q |
543 |
tttcactatcaaacacaatggacctggtcttcgatcaatggctaatggtattagttctttat-acatgataaatgagttactcaacttctcactatctca |
641 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2298842 |
tttcactatcaaacacaatggacctggtcttcgatcaatggcaaatggtattagttctttataacatgataaatgagttactcaacttctcactatctca |
2298941 |
T |
|
| Q |
642 |
ttttaaacactactttgtgtggttcatatgatgaatgagtttaat |
686 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2298942 |
tttataacactactttgtgtggttcatatgatgaatgagtttaat |
2298986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 178; E-Value: 1e-95
Query Start/End: Original strand, 235 - 428
Target Start/End: Original strand, 2298520 - 2298713
Alignment:
| Q |
235 |
ctgatttgttgtgtccgcgttttcaatttatgcgttttatgttggctttgccacaatggtttacactatatctaaaagaatataattttagtttattgca |
334 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
2298520 |
ctgatttgttgtgtcagcgttttcaatttatgcgttttatgttggctttgccacaatggtttacactatatataaaagaatataatttaagtttattgca |
2298619 |
T |
|
| Q |
335 |
gactttttcctcaattgaattttttgtatcttatcaaattggtaataatgtcagccatgttgtttttgttattaagatgctatgtttatttcat |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2298620 |
gactttttcctcaattgaattttttgtatcttatcaaattggtaataatgtaagccatgttgtttttgttattaagatgctatgtttatttcat |
2298713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 98 - 232
Target Start/End: Original strand, 2298357 - 2298491
Alignment:
| Q |
98 |
tttcgggtgacgattgcttaagataatctttttctctctgatttaattacagggataagcttgggtgaaacattttttcatgtgaaagttgcttatgata |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2298357 |
tttcgggtgacgattgcttaagataatctttttctctctgatttaattacagggataagcttgggtgaaatattttttcatgtgaaagttgcttatgata |
2298456 |
T |
|
| Q |
198 |
cacacaataggtatgaatttcaacattttttcaca |
232 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2298457 |
cacacaaaaggtatgaatttcaacattttttcaca |
2298491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 504 - 583
Target Start/End: Complemental strand, 14955119 - 14955041
Alignment:
| Q |
504 |
tgtgtttccatctatggactgaagttttgatcaagataatttcactatcaaacacaatggacctggtcttcgatcaatgg |
583 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||| | || ||||| ||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
14955119 |
tgtgcttccatctatggactaaagttt-gatgatgaaaattttactgccaaacacactggacctggtcttctatcaatgg |
14955041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 524 times since January 2019
Visitors: 1096