View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0024_high_2 (Length: 288)
Name: NF0024_high_2
Description: NF0024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0024_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 36 - 156
Target Start/End: Complemental strand, 43617941 - 43617819
Alignment:
| Q |
36 |
aaaaagttccat--attagttgtataaaaggagtgagcagtttgcatgtcgggactgagttcatatatgctcaatttacacaaggctccatttaggcaat |
133 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| || |||| |||| |||||||||||||||||||||| ||||| ||||| ||| ||||||||||| |
|
|
| T |
43617941 |
aaaaagttccatttattagttgtataaaaggagtgaccaatttggatgttgggactgagttcatatatgctccatttatacaagactctatttaggcaat |
43617842 |
T |
 |
| Q |
134 |
ttaccatcatggatgcaacacac |
156 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43617841 |
ttaccatcatggatgcaacacac |
43617819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 98 - 156
Target Start/End: Complemental strand, 29381114 - 29381056
Alignment:
| Q |
98 |
atatgctcaatttacacaaggctccatttaggcaatttaccatcatggatgcaacacac |
156 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
29381114 |
atatgctccatttacacaaggctccatttaggccctttacaatcatggatgcaacacac |
29381056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University