View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0024_high_5 (Length: 262)
Name: NF0024_high_5
Description: NF0024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0024_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 22 - 223
Target Start/End: Original strand, 23338810 - 23339009
Alignment:
Q |
22 |
gatgaatcgtagtatatgattttataatgtttagatagactttaacacatcttaaaacgtggttgaagtttattcaaattttacaaaacttatttaaaag |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
T |
23338810 |
gatgaatcgtagtatatgattttataatgtttagatagactttaacacatctt-aaacgttgttgaagtttattcaaattttacaaaacttatttgaaag |
23338908 |
T |
 |
Q |
122 |
acgaannnnnnnnncatgtatacactcatattgaggatttttggagagtctagagatgtaagaataacaccgatttaatgctctatgattcactcctgct |
221 |
Q |
|
|
||||| |||||||||||||||| ||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
23338909 |
acgaa-acttttttcatgtatacactcatactgaggatttttagagagtctaaagatgtaggaataacaccgatttaatgctctatgattcactcccgct |
23339007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 590 times since January 2019
Visitors: 1099