View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0024_low_3 (Length: 308)
Name: NF0024_low_3
Description: NF0024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0024_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 68 - 245
Target Start/End: Original strand, 21031894 - 21032071
Alignment:
Q |
68 |
aagggagagatgtggtaaagattaaattggtgtgaaatgtcatttcaatatacagtatatgtatccagcagaagggatatttacactgttgtattcatct |
167 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21031894 |
aagggagagatgtggtaaagattaaattggtgtgaaatgtcatttcaatatacagtatatgtatccagcagaagggatatttacactgttgtattcatct |
21031993 |
T |
 |
Q |
168 |
gtatatatcagctagcccaaacaacaaaacatgggctccacatcttgtagttttaacctttttcccattctttgtttc |
245 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21031994 |
gtatatatcagctagcccaaacaacaaaacatgggctccacatcttgtagttttaacctttttcccattctttgtttc |
21032071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 295
Target Start/End: Original strand, 21032084 - 21032117
Alignment:
Q |
262 |
ttactcaaagctgcaaataagatcgacccacttc |
295 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
21032084 |
ttactcaaagctgcaaataagatcgacccacttc |
21032117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University