View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0024_low_9 (Length: 254)
Name: NF0024_low_9
Description: NF0024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0024_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 50 - 244
Target Start/End: Original strand, 47406908 - 47407102
Alignment:
| Q |
50 |
aatcattaagaattggattcagttttggcataaatggaaatatgacttgcattactaactcaagttcaggcataaaggtaacttggggtttacaatggag |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47406908 |
aatcattaagaattggattcagttttggcacaaatggaaatatgactgatattactaactcaagttcaggcataaaggtaacttggggtttacaagggag |
47407007 |
T |
 |
| Q |
150 |
caccccagtcggaaaccaaaataacaacacgtccatgaaataaagcaaaacatcaaaacagtatgagcttgggccctaatctaactctctgctcc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47407008 |
caccccagtcggaaaccaaaataacaacacgtccatgaaataaagcaaaacatcaaaacagtatgagcttgggccctaatctaactgtctgctcc |
47407102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University