View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0025_low_2 (Length: 310)
Name: NF0025_low_2
Description: NF0025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0025_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 20 - 243
Target Start/End: Complemental strand, 39076443 - 39076220
Alignment:
Q |
20 |
gacatcatcattgcattgtctaaacatttacttgcactaatttgtatttaattgactaagtatatgcggctcaacaattatgcgaagaaaacactgaatg |
119 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
39076443 |
gacatcatcattgcattgtctaaacatttacttgcactaatttgtttttaattgactaagtatatgcagctcaacaattatgcgaagaaaacactgaatg |
39076344 |
T |
 |
Q |
120 |
aagacttatatagttaagcaattaatgtccatgcatttagcttgttaagacaaattcatatttgttcgtgcaatcgaaagagctttttgttcaacctgca |
219 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
39076343 |
aagacttatatagttaagcaattaatgtccatgcatttagcttgttaagacaaattcatatttgttcgtgcaatcgaaaaagctttttgttcaacctgca |
39076244 |
T |
 |
Q |
220 |
cttgttttactttttcataaatgc |
243 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
39076243 |
cttgttttactttttcataaatgc |
39076220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University