View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0025_low_3 (Length: 309)
Name: NF0025_low_3
Description: NF0025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0025_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 28 - 240
Target Start/End: Original strand, 30443905 - 30444117
Alignment:
| Q |
28 |
catcatctaatgtcaatgttctcaatgctttgtgatattctattgcctgttgatttctatccaacttacaactgtcttacaaatcatttaatgtaggtta |
127 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30443905 |
catcatctaatttcaatgttctcaatgctttgtgatattatattgcctgttgatttctatccaacttacaactgtcttacaaatcatttaatgtaggtta |
30444004 |
T |
|
| Q |
128 |
ttttcactgggggccgcacacaacctggaactaccaagcccgatgagggcgaacgccatccttactccataatagagtatgaggcaacacgtgaagtcat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30444005 |
ttttcactgggggccgcacacaacctggaactaccaaacccgatgagggcgaacgccatccttactccataatagagtatgaggcaacacgtgaagtcat |
30444104 |
T |
|
| Q |
228 |
tttgccatctgtg |
240 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30444105 |
tttgccatctgtg |
30444117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 598 times since January 2019
Visitors: 1099