View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0025_low_4 (Length: 299)
Name: NF0025_low_4
Description: NF0025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0025_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 49 - 227
Target Start/End: Complemental strand, 34223659 - 34223482
Alignment:
| Q |
49 |
ccctagctgttgcatccctcggtgccttcaactgcgctcaacaggtagttcgtctgctctgcgatccaacatatcaaatgtttctatgaagctaaataat |
148 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34223659 |
ccctagctgtttcatccctcggtgccttcaactgcgctcaacaggtagttcgtctactctgcgatccaacatatcaaatgtttctatgaagctaaataat |
34223560 |
T |
 |
| Q |
149 |
aatttatgaattaggtgctgccgggaatggttgaaagaggaaagggaacaattctattcactggttgctctgcttcttt |
227 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34223559 |
ga-ttatgaattaggtgctgccgggaatggttgaaagaggaaagggaacaattctattcactggttgctctgcttcttt |
34223482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University