View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0025_low_5 (Length: 250)
Name: NF0025_low_5
Description: NF0025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0025_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 7 - 108
Target Start/End: Original strand, 34966779 - 34966880
Alignment:
Q |
7 |
atctctgatattgctatttgtaccacaacttgctcaactattattctctctgattaatcaatctcactctttcaaatggtaaatattacatatctgtctc |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
T |
34966779 |
atctctgatattgctatttgtaccacaacttgctcaactattattctctctgattaatcaaactcactctttcaaatggtaaaatttacatatctgtctc |
34966878 |
T |
 |
Q |
107 |
tg |
108 |
Q |
|
|
|| |
|
|
T |
34966879 |
tg |
34966880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 620 times since January 2019
Visitors: 1099