View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0025_low_5 (Length: 250)

Name: NF0025_low_5
Description: NF0025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0025_low_5
NF0025_low_5
[»] chr5 (1 HSPs)
chr5 (7-108)||(34966779-34966880)


Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 7 - 108
Target Start/End: Original strand, 34966779 - 34966880
Alignment:
7 atctctgatattgctatttgtaccacaacttgctcaactattattctctctgattaatcaatctcactctttcaaatggtaaatattacatatctgtctc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||  |||||||||||||||    
34966779 atctctgatattgctatttgtaccacaacttgctcaactattattctctctgattaatcaaactcactctttcaaatggtaaaatttacatatctgtctc 34966878  T
107 tg 108  Q
    ||    
34966879 tg 34966880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University