View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0027_low_4 (Length: 415)
Name: NF0027_low_4
Description: NF0027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0027_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 8e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 33 - 193
Target Start/End: Original strand, 44318287 - 44318447
Alignment:
| Q |
33 |
tggcaaagtcttcatggtcagnnnnnnnggtgcagattcaaattcaaattcttcaaacggaatattcgccatgaaggttatgagaaaagacaacatcatt |
132 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44318287 |
tggcaaagtcttcatggtcagaaaaaaaggtggagattcaaattcaaattcttcaaacggaatattcgccatgaaggttatgagaaaagacaacatcatt |
44318386 |
T |
 |
| Q |
133 |
aagaaaaatcatgttgattatatgaaagctgagagagatattcttactaaagttcttcatc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44318387 |
aagaaaaatcatgttgattatatgaaagctgagagagatattcttactaaagttcttcatc |
44318447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 300 - 404
Target Start/End: Original strand, 44318538 - 44318642
Alignment:
| Q |
300 |
attttatatttaattaacttacttaatgtttatgtttacttgcagactaaatctaaattatatttgattttggactttataaatggtggccatcttttct |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44318538 |
attttatatttaattaacttacttaatgtttatgtttacttgcagactaaatctaaattatatttgattttggactttataaatggtggccatcttttct |
44318637 |
T |
 |
| Q |
400 |
ttcat |
404 |
Q |
| |
|
||||| |
|
|
| T |
44318638 |
ttcat |
44318642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University