View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0027_low_5 (Length: 377)
Name: NF0027_low_5
Description: NF0027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0027_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 34675040 - 34675366
Alignment:
| Q |
1 |
ccattgagttttgtaataacttttgaaactaaaactgattattacttgaaaacacgatgta--gaagggaaagttagaagataaatagattcatattttg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675040 |
ccattgagttttgtaataacttttgaaactaaa-ctgattattacttgaaaacacgatgtatagaagggaaagttagaagataaatagattcatattttg |
34675138 |
T |
|
| Q |
99 |
tatgactcaatannnnnnn-attgctttgtagcgcaggagaaaaaatggcatcatcaagctcatacaattcaccatgtgcagcctgcaaattccttcgtc |
197 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675139 |
tatgactcaatattttttttattgctttgtagcgcaggagaaaaaatggcatcatcaagctcatacaattcaccatgtgcagcctgcaaattccttcgtc |
34675238 |
T |
|
| Q |
198 |
gaaaatgcatgccaggctgcatctttgcaccatactttccaccggaagaacctcaaaaatctgcaaacgttcacaagatcttcggcgcaagcaacgtcac |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675239 |
gaaaatgcatgccaggctgcatctttgcaccatactttccaccggaagaacctcaaaaatttgcaaacgttcacaagatcttcggcgcaagcaacgtcac |
34675338 |
T |
|
| Q |
298 |
aaagaccctcaacgaactcctccctcac |
325 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
34675339 |
aaagatcctcaacgaactcctccctcac |
34675366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 139 - 325
Target Start/End: Original strand, 43583166 - 43583355
Alignment:
| Q |
139 |
aaaaatggcatcatca---agctcatacaattcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatacttt |
235 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||| |||||||||||| | | |||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
43583166 |
aaaaatggcatcatcatccagctcatacaattcaccttgtgctgcctgcaaattcttgaggagaaaatgcatgccaggatgcatctttgcaccttacttc |
43583265 |
T |
|
| Q |
236 |
ccaccggaagaacctcaaaaatctgcaaacgttcacaagatcttcggcgcaagcaacgtcacaaagaccctcaacgaactcctccctcac |
325 |
Q |
| |
|
|| || ||||| |||||||||| ||||||||| ||||| || || || || ||||| ||||||||| ||||| ||||| ||||||||| |
|
|
| T |
43583266 |
cctccagaagagcctcaaaaatttgcaaacgtgcacaaaatatttggtgctagcaatgtcacaaagcttctcaatgaacttctccctcac |
43583355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 705 times since January 2019
Visitors: 1103