View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0027_low_8 (Length: 276)
Name: NF0027_low_8
Description: NF0027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0027_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 55 - 146
Target Start/End: Original strand, 12709050 - 12709141
Alignment:
| Q |
55 |
cagaatggggtcctcttcttcggttttcacttcattagaatcttccccaatttcactaggattttcctcttcacttacctcttcatggaaag |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12709050 |
cagaatggggtcctcttcttcggttttcacttcattagaatcctccccaatttcactaggattttcctcttcacttacctcttcatggaaag |
12709141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 244
Target Start/End: Original strand, 12709200 - 12709239
Alignment:
| Q |
205 |
gcatttgcttctcattcttgccttccttcctaggtatctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12709200 |
gcatttgcttctcattcttgccttccttcctaggtatctc |
12709239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 559 times since January 2019
Visitors: 1098