View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0027_low_8 (Length: 276)

Name: NF0027_low_8
Description: NF0027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0027_low_8
NF0027_low_8
[»] chr4 (2 HSPs)
chr4 (55-146)||(12709050-12709141)
chr4 (205-244)||(12709200-12709239)


Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 55 - 146
Target Start/End: Original strand, 12709050 - 12709141
Alignment:
55 cagaatggggtcctcttcttcggttttcacttcattagaatcttccccaatttcactaggattttcctcttcacttacctcttcatggaaag 146  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
12709050 cagaatggggtcctcttcttcggttttcacttcattagaatcctccccaatttcactaggattttcctcttcacttacctcttcatggaaag 12709141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 244
Target Start/End: Original strand, 12709200 - 12709239
Alignment:
205 gcatttgcttctcattcttgccttccttcctaggtatctc 244  Q
    ||||||||||||||||||||||||||||||||||||||||    
12709200 gcatttgcttctcattcttgccttccttcctaggtatctc 12709239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University