View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028-INSERTION-11 (Length: 218)
Name: NF0028-INSERTION-11
Description: NF0028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0028-INSERTION-11 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 119 - 218
Target Start/End: Original strand, 27661939 - 27662038
Alignment:
| Q |
119 |
aagttgttttcattctaattctttcattaagcttgtttccgattgtttactgatgtttttgtaaacaaaaacattacttttaaaagttacttgtacgatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| || | || ||||||||||||| |||| |||| |
|
|
| T |
27661939 |
aagttgttttcattctaattctttcattaagcttgtttctgattgtttcctgatgtttttgtaaacaagaagactagttttaaaagttacctgtaggatc |
27662038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 27661895 - 27661938
Alignment:
| Q |
7 |
aactttgatatacttgtgaatcactctcataaatatgacatgct |
50 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
27661895 |
aactttgatatatttgtgaatcactctcataaatctgacatgct |
27661938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 621 times since January 2019
Visitors: 1099