View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0028-INSERTION-11 (Length: 218)

Name: NF0028-INSERTION-11
Description: NF0028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0028-INSERTION-11
NF0028-INSERTION-11
[»] chr8 (2 HSPs)
chr8 (119-218)||(27661939-27662038)
chr8 (7-50)||(27661895-27661938)


Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 119 - 218
Target Start/End: Original strand, 27661939 - 27662038
Alignment:
119 aagttgttttcattctaattctttcattaagcttgtttccgattgtttactgatgtttttgtaaacaaaaacattacttttaaaagttacttgtacgatc 218  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| || | || ||||||||||||| |||| ||||    
27661939 aagttgttttcattctaattctttcattaagcttgtttctgattgtttcctgatgtttttgtaaacaagaagactagttttaaaagttacctgtaggatc 27662038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 27661895 - 27661938
Alignment:
7 aactttgatatacttgtgaatcactctcataaatatgacatgct 50  Q
    |||||||||||| ||||||||||||||||||||| |||||||||    
27661895 aactttgatatatttgtgaatcactctcataaatctgacatgct 27661938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 621 times since January 2019
Visitors: 1099