View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028-INSERTION-15 (Length: 231)
Name: NF0028-INSERTION-15
Description: NF0028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0028-INSERTION-15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 8 - 228
Target Start/End: Original strand, 21950499 - 21950720
Alignment:
Q |
8 |
ctttctagtagaaataataatggtgagtagtcagtcatttctgtttcattttatnnnnnnnnnnnnnnnnnnncgctgctgttgtcgtcgtcgtca-cac |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||| |||||| ||| ||| |
|
|
T |
21950499 |
ctttctagtagaaataataatggtgagtagtcagtactttctgtttcattttatttgttgttgttgtcgttgctgctgttgttgttgtcgtcatcaacac |
21950598 |
T |
 |
Q |
107 |
tcactcaaattcatgtgcgtttaggtttcaatattcaattcacaacaccgttacaacgaatgtggagttcaattaccaccactcgtggtgatcgaggcaa |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21950599 |
tcactcaaattcatgtgcgtttaggtttcaatattcaattcacaacaccgttacaacgaatgtggagttcaattaccaccactcgtggtgatcgaggcaa |
21950698 |
T |
 |
Q |
207 |
agctgtggtggaggaggaggag |
228 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
21950699 |
agctgtggtggaggaggaggag |
21950720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 547 times since January 2019
Visitors: 1098