View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028-INSERTION-5 (Length: 149)
Name: NF0028-INSERTION-5
Description: NF0028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0028-INSERTION-5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 8 - 136
Target Start/End: Original strand, 42700896 - 42701024
Alignment:
Q |
8 |
cattattgattctacaatgcaggcatcagagcagcatagaagttcaagtatgtactatcaaccattgcagcaaatcgaagcctattgcttgccacaatat |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42700896 |
cattattgattctacaatgcaggcatcagagcagcatagaagttcaagtatgtactatcaaccattgcagcaaatcgaagcctattgcttgccacaatat |
42700995 |
T |
 |
Q |
108 |
cgaaatctaaatcatcagctatacaacaa |
136 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
42700996 |
cgaaatctaaatcatcagctatacaacaa |
42701024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University