View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028-INSERTION-6 (Length: 239)
Name: NF0028-INSERTION-6
Description: NF0028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0028-INSERTION-6 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 239
Target Start/End: Complemental strand, 39378730 - 39378498
Alignment:
Q |
7 |
aaattccgagtaacgcaaccgttgatctatcattcaacaatctcactggtgaaataccagagtcccctgttttgttgaaccaggaaacaaaagtgttttc |
106 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39378730 |
aaattcccagtaacgcaaccgttgatctatcattcaacaatctcactggcgaaataccggagtcccctgttttgttgaaccaggaaacaaaagtgttttc |
39378631 |
T |
 |
Q |
107 |
tggtaatagtgatctatgtggtgaaccaatgaaaaatccttgttctattccttcttctccttcttctaatcctcaaggttcttctcctcctgcaatcgcc |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
39378630 |
tggtaatagtgatctatgtggtgaaccaatgaaaaatccttgttctattccttcttctccttcttctaatcctcaaggttcttctcctcctgcactcgcc |
39378531 |
T |
 |
Q |
207 |
gcaatgccgaagaattttgataatgattctcct |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
39378530 |
gcaatgccgaagaattttgataatgattctcct |
39378498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University