View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028-INSERTION-7 (Length: 244)
Name: NF0028-INSERTION-7
Description: NF0028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0028-INSERTION-7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 8 - 242
Target Start/End: Complemental strand, 34359723 - 34359491
Alignment:
| Q |
8 |
aatatatggtcagggaaatcaatcatagaagtgaaagaagttaagctcctaccttcttcnnnnnnn-gtatttacccttaagttattattagggaaagaa |
106 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||| |||| || || ||||||| |||| |||| ||| ||||||||| |
|
|
| T |
34359723 |
aatatatggtcaagcaaatcaatcatagaagtgaaagaagttaagcttctacattttttttttttttgtatttatccttcagttgtta---gggaaagaa |
34359627 |
T |
|
| Q |
107 |
accctaataatatgaagttcgatcagaagataagtattgtctggtcaagaattgttccattcataaatctttcaattttaaacataattgtcctcgcaag |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||| | | |||||||||||||||| ||||||| |
|
|
| T |
34359626 |
accctaataatatgaagttcgaccagaagataagtattgtctggttaagaattgttccatccataaatctcttagttttaaacataattgtactcgcaaa |
34359527 |
T |
|
| Q |
207 |
aaaaatacaactgtcatctaaaatgtgactactact |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34359526 |
aaaaatacaactgtcatctaaaatgtgactactact |
34359491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 583 times since January 2019
Visitors: 1098