View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028Ase3 (Length: 134)
Name: NF0028Ase3
Description: NF0028-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0028Ase3 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 3e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 13466428 - 13466554
Alignment:
Q |
8 |
gaagacatgtggcaaattgattttagttggtgcatcagttacacctcctatcttgccatatatgcctttaatgtctggtaaattataaataaccttgtaa |
107 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13466428 |
gaagacatgtggcaaattaattttagttggtgcatcagttacacctcctatcttgccatatatgcctttaatgtctggtaaattataaataaccttgtaa |
13466527 |
T |
 |
Q |
108 |
tgcttgataattatttttactcttgat |
134 |
Q |
|
|
||||||||||||||||| ||||||||| |
|
|
T |
13466528 |
tgcttgataattattttaactcttgat |
13466554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University