View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0028Ase5 (Length: 180)

Name: NF0028Ase5
Description: NF0028-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0028Ase5
NF0028Ase5
[»] chr8 (1 HSPs)
chr8 (9-120)||(39917454-39917565)


Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 9 - 120
Target Start/End: Original strand, 39917454 - 39917565
Alignment:
9 taccatacctatcgttgatgtttcaacttctactgctccactacctgctaccaccgtcgccgggaatggttttttcaaattttctggaaccgggattgtc 108  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39917454 taccatacctatcgttggtgtttcaacttctactgctccactacctgctaccaccgtcgccgggaatggttttttcaaattttctggaaccgggattgtc 39917553  T
109 aacaagttttga 120  Q
    ||||||||||||    
39917554 aacaagttttga 39917565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University