View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028Ase5 (Length: 180)
Name: NF0028Ase5
Description: NF0028-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0028Ase5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 9 - 120
Target Start/End: Original strand, 39917454 - 39917565
Alignment:
Q |
9 |
taccatacctatcgttgatgtttcaacttctactgctccactacctgctaccaccgtcgccgggaatggttttttcaaattttctggaaccgggattgtc |
108 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39917454 |
taccatacctatcgttggtgtttcaacttctactgctccactacctgctaccaccgtcgccgggaatggttttttcaaattttctggaaccgggattgtc |
39917553 |
T |
 |
Q |
109 |
aacaagttttga |
120 |
Q |
|
|
|||||||||||| |
|
|
T |
39917554 |
aacaagttttga |
39917565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 535 times since January 2019
Visitors: 1096