View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028Ase7 (Length: 175)
Name: NF0028Ase7
Description: NF0028-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0028Ase7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 8e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 8e-66
Query Start/End: Original strand, 9 - 175
Target Start/End: Complemental strand, 36109489 - 36109322
Alignment:
| Q |
9 |
cattcaatcattttcgaaatgaaatttgcacaatgcatgggagatatcccaatttagctttatttatagagtagtggagtgtttgacttcgtaaccacgt |
108 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36109489 |
cattcaatcattttcaaaatgaaatttgcacaatgcatgggagatatcccaatttagctttatttatagagtagtggagtgtttgacttcgtaatcacgt |
36109390 |
T |
 |
| Q |
109 |
gaaagtggaacctgtttgaataggatgct-nnnnnnntaacttatttgctgattgatgtcgatagtat |
175 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36109389 |
gaaagtggaacctgtttgaataggatgctaaaaaaaacaacttatttgctgattgatgtcgatagtat |
36109322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University