View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028Ase8 (Length: 191)
Name: NF0028Ase8
Description: NF0028-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0028Ase8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 7 - 186
Target Start/End: Original strand, 5830897 - 5831077
Alignment:
| Q |
7 |
atgaccagtggcttctatcactagctaaaaaagtgtagcaaccaatagctttgcagatcttgattattccaatacttatggaccatgccagccagaaaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5830897 |
atgaccagtggcttctatcactagctaaaaaagtgtagcaaccaatagctttgcagattttgattattccaatacttatggaccatgccagccagaaaaa |
5830996 |
T |
 |
| Q |
107 |
agatcacaaag-catcacaacttgattcacaatttatgatcaccatccctttcatctgctagggtttctagagagcaacaa |
186 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5830997 |
agatcacaaagccatcacaacttgattcacaatttatgatcaccatccttttcatctgctagggtttctagagagcaacaa |
5831077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University