View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0028Eco17 (Length: 194)

Name: NF0028Eco17
Description: NF0028-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0028Eco17
NF0028Eco17
[»] chr3 (1 HSPs)
chr3 (10-194)||(45645912-45646097)


Alignment Details
Target: chr3 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 10 - 194
Target Start/End: Original strand, 45645912 - 45646097
Alignment:
10 cttggcaactgtagagttggagctagtgatttaattacaagatgggatggtaattaggtaactgg-ttaacagctttcttgatattttacataatactta 108  Q
    |||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||||    
45645912 cttggcgactgtagagttggagctagtgatttaattagaagatgcgatggtaattaggtaactgggttaacagctttcttgatattgtacataatactta 45646011  T
109 tgcggaactgatggcattgttttttggnctganccttgccaataatatcggntgcnntcgagtttgttcctattaagaatcnaaaa 194  Q
    |||||||||||||||||||||| |||| ||||  ||||  ||||||||||| |||  || ||||||||||||||||||||| ||||    
45646012 tgcggaactgatggcattgtttcttggtctgaagcttgttaataatatcggttgcaatcaagtttgttcctattaagaatcgaaaa 45646097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University