View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028Eco17 (Length: 194)
Name: NF0028Eco17
Description: NF0028-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0028Eco17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 10 - 194
Target Start/End: Original strand, 45645912 - 45646097
Alignment:
| Q |
10 |
cttggcaactgtagagttggagctagtgatttaattacaagatgggatggtaattaggtaactgg-ttaacagctttcttgatattttacataatactta |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
45645912 |
cttggcgactgtagagttggagctagtgatttaattagaagatgcgatggtaattaggtaactgggttaacagctttcttgatattgtacataatactta |
45646011 |
T |
|
| Q |
109 |
tgcggaactgatggcattgttttttggnctganccttgccaataatatcggntgcnntcgagtttgttcctattaagaatcnaaaa |
194 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| |||| ||||||||||| ||| || ||||||||||||||||||||| |||| |
|
|
| T |
45646012 |
tgcggaactgatggcattgtttcttggtctgaagcttgttaataatatcggttgcaatcaagtttgttcctattaagaatcgaaaa |
45646097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 643 times since January 2019
Visitors: 1100