View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028Eco29 (Length: 291)
Name: NF0028Eco29
Description: NF0028-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0028Eco29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 8 - 290
Target Start/End: Original strand, 29072038 - 29072322
Alignment:
| Q |
8 |
cttatcactcttagtagaat--gaatggtgaactattaaccgtgcaaggttaaaaatgttgggagtgtttgtttcaccaacttcttacttttttgattca |
105 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29072038 |
cttatcactcttagtagaatatgaatggtgaactattaaccgtgcaaggttaaaaatgttgggagtgtttgtttcaccgacttcttacttttttgattca |
29072137 |
T |
|
| Q |
106 |
aacaaaccaaatgaaactcgttaaaatggttcccccataattgttgccacatcgaaacgatgatagcttttagccaaaatggttgtactccagctcagta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29072138 |
aacaaaccaaatgaaactcgttaaaatggttcccccataattgttgccacatcgaaacgatgatagcttttagccaaaatggttgtactccagctcagta |
29072237 |
T |
|
| Q |
206 |
gctctctaaccctaggccaagattctgatagcaaacaaacagtttctaattgtaaaaatagctatgaacaagggtcgcttttcat |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29072238 |
gctctctaaccctaggccaagattctgatagcaaacaaacagtttctaattgtaaaaatagctatgaacaagggtcgcttttcat |
29072322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 558 times since January 2019
Visitors: 1098