View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0028_high_4 (Length: 382)

Name: NF0028_high_4
Description: NF0028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0028_high_4
NF0028_high_4
[»] chr4 (2 HSPs)
chr4 (97-218)||(46981332-46981453)
chr4 (216-265)||(46981488-46981537)
[»] chr7 (1 HSPs)
chr7 (217-257)||(12278827-12278867)


Alignment Details
Target: chr4 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 97 - 218
Target Start/End: Original strand, 46981332 - 46981453
Alignment:
97 atcttgtctccaaccagggagttgtcttgccaggtttttgttcttaatcctctattttttattggtctttaattttagaatgggtttagctctatagcac 196  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46981332 atcttgtctccaactagggagttgtcttgccaggtttttgttcttaatcctctattttttattggtctttaattttagaatgggtttagctctatagcac 46981431  T
197 cgaaacttatgatcgaagatat 218  Q
    ||||||||||||||||||||||    
46981432 cgaaacttatgatcgaagatat 46981453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 216 - 265
Target Start/End: Original strand, 46981488 - 46981537
Alignment:
216 tattatgtcattttcttatattactaccagtgttggtgttggtgtctgtg 265  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
46981488 tattatgtcattttcttatattactaccagtgttggtgttggtgtctgtg 46981537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 217 - 257
Target Start/End: Complemental strand, 12278867 - 12278827
Alignment:
217 attatgtcattttcttatattactaccagtgttggtgttgg 257  Q
    ||||||||||||||||| |||| || |||||||||||||||    
12278867 attatgtcattttcttaaattattatcagtgttggtgttgg 12278827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University