View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028_high_4 (Length: 382)
Name: NF0028_high_4
Description: NF0028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0028_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 97 - 218
Target Start/End: Original strand, 46981332 - 46981453
Alignment:
Q |
97 |
atcttgtctccaaccagggagttgtcttgccaggtttttgttcttaatcctctattttttattggtctttaattttagaatgggtttagctctatagcac |
196 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46981332 |
atcttgtctccaactagggagttgtcttgccaggtttttgttcttaatcctctattttttattggtctttaattttagaatgggtttagctctatagcac |
46981431 |
T |
 |
Q |
197 |
cgaaacttatgatcgaagatat |
218 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
46981432 |
cgaaacttatgatcgaagatat |
46981453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 216 - 265
Target Start/End: Original strand, 46981488 - 46981537
Alignment:
Q |
216 |
tattatgtcattttcttatattactaccagtgttggtgttggtgtctgtg |
265 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46981488 |
tattatgtcattttcttatattactaccagtgttggtgttggtgtctgtg |
46981537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 217 - 257
Target Start/End: Complemental strand, 12278867 - 12278827
Alignment:
Q |
217 |
attatgtcattttcttatattactaccagtgttggtgttgg |
257 |
Q |
|
|
||||||||||||||||| |||| || ||||||||||||||| |
|
|
T |
12278867 |
attatgtcattttcttaaattattatcagtgttggtgttgg |
12278827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University