View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0028_low_15 (Length: 214)

Name: NF0028_low_15
Description: NF0028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0028_low_15
NF0028_low_15
[»] chr8 (1 HSPs)
chr8 (154-194)||(33548912-33548952)


Alignment Details
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 33548952 - 33548912
Alignment:
154 cttcattcattcaatttaataaataatacatcggacaacac 194  Q
    |||||||||||||||||||||||||||||||||||||||||    
33548952 cttcattcattcaatttaataaataatacatcggacaacac 33548912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University