View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028_low_3 (Length: 490)
Name: NF0028_low_3
Description: NF0028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0028_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 9e-99; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 9e-99
Query Start/End: Original strand, 275 - 461
Target Start/End: Complemental strand, 4175465 - 4175279
Alignment:
| Q |
275 |
gtagtatcttattttagatatttatcattattggtttttgtcattgttacaataaatatttatgaaatgtatgggctattgtgcagccaagagttgcgtg |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4175465 |
gtagtatcttattttagatatttatcattattggtttttgtcattgttacaacaaatatttatgaaatgtatgggctattgtgcagccaagagttgcgtg |
4175366 |
T |
|
| Q |
375 |
cagtggagaggagggtacttttggaaaccttggctggacaactgcctacggataccattcaatattcttcacggttggtcaagattg |
461 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4175365 |
cagtggagaggagggtacttttggaaaccttggctggacaactgcctacggataccattcaatattcttcacggttggtcaagattg |
4175279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 165 - 257
Target Start/End: Complemental strand, 4175843 - 4175751
Alignment:
| Q |
165 |
taggaattgagaccaagaagaatgttatcggcactctctttctaacaatagaatagtccctaacaacatacattgcttatgaatttcatagaa |
257 |
Q |
| |
|
||||||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4175843 |
taggaattgagactaagaagagtgttatcgacactctctttctaacaatagaatagtccctaacaacatacattgcttatgaatttcaaagaa |
4175751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 329 - 461
Target Start/End: Complemental strand, 4171423 - 4171289
Alignment:
| Q |
329 |
aatatttatgaaatgtat--gggctattgtgcagccaagagttgcgtgcagtggagaggagggtacttttggaaaccttggctggacaactgcctacgga |
426 |
Q |
| |
|
||||||||||||||| || ||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||||| || | ||| | || |
|
|
| T |
4171423 |
aatatttatgaaatgcataaggggtattgtgcagccaagaggtgcgtgcagtggagaggagagtacttttggaaactttggctgctcagttacctcctga |
4171324 |
T |
|
| Q |
427 |
taccattcaatattcttcacggttggtcaagattg |
461 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |
|
|
| T |
4171323 |
tagcattcaatattcttcacggttggtcaagattg |
4171289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 120 - 164
Target Start/End: Complemental strand, 40948398 - 40948354
Alignment:
| Q |
120 |
acaggagaaaactggaggcatttatacaggagacaatccattccc |
164 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
40948398 |
acaggagaaaactggaggcatttacaccggagaaaatccattccc |
40948354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 661 times since January 2019
Visitors: 1100