View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0028b17 (Length: 145)
Name: NF0028b17
Description: NF0028-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0028b17 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 7 - 145
Target Start/End: Complemental strand, 36792608 - 36792470
Alignment:
| Q |
7 |
aattataccccattttctcttcctacaacatgaatacttctctttttaaaccgctatcaacattcaacgatacaaacaaacaataagtttcaagcaacta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36792608 |
aattataccccattttctcttcctacaacatgaatacttctctttttaaaccgctatcaacattcaacgatacaaacaaacaataagtttcaagcaacta |
36792509 |
T |
|
| Q |
107 |
tttctaaattaaagtaaccaaaaccatatcacctaaaat |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36792508 |
tttctaaattaaagtaaccaaaaccatatcatctaaaat |
36792470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 578 times since January 2019
Visitors: 1098