View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0029-Insertion-9 (Length: 201)
Name: NF0029-Insertion-9
Description: NF0029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0029-Insertion-9 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 105 - 201
Target Start/End: Original strand, 38472556 - 38472651
Alignment:
| Q |
105 |
caggttcagagagagagaacaaatcttgaactgattttgactcaattgttgactccaccaatgacttctttcaatttcgatttagtcagtataatct |
201 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38472556 |
caggttcagagagagaga-caaatcttgaactgattttgactcaattgttgactccaccaatgacttctttcaatttcgatttagtcagtacaatct |
38472651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 15 - 72
Target Start/End: Original strand, 38472438 - 38472495
Alignment:
| Q |
15 |
ccctctctctaaaactatcccttcatcttgcatacacgagattcaattgacacaacta |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38472438 |
ccctctctctaaaactatcccttcatcttgcatacacgagattcaattgacacaacta |
38472495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 105 - 200
Target Start/End: Original strand, 46017910 - 46018005
Alignment:
| Q |
105 |
caggttcagagagagagaacaaatcttgaactgattttgactcaattgttgactccaccaatgacttctttcaatttcgatttagtcagtataatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||| ||| |||| |
|
|
| T |
46017910 |
caggttcagagagagagaacaaatcttgaactgattttgactcaattgttgactccatcaatgacttcttccaattccgatttagtccgtacaatc |
46018005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 649 times since January 2019
Visitors: 1100