View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0029_high_1 (Length: 346)
Name: NF0029_high_1
Description: NF0029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0029_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 34674473 - 34674220
Alignment:
Q |
1 |
tagtgcatatagcaacacttacatgtatatatgtatctttcttcttccggaattcagctccacatgaccaagaaaaaagttatatatatagatttcatca |
100 |
Q |
|
|
||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
T |
34674473 |
tagtgcatacagcaaaacttacatgtatatatgtatctttcttcgtccggaattcagctctacatgaccaagtaaaaagttatatatatagatttcatcg |
34674374 |
T |
 |
Q |
101 |
caaaactaaataaatcgaaccaaagatctggctgcagcaaagaactaca---tcataaaataaaagcatagaaattgggcaaagccctaaatagtgtctt |
197 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
T |
34674373 |
caaaactaaataaattgaaccaaagatctggctgcagcaaagaactacatcatcataaaataaaggcatataaattgggcaaagccctaaatagtgtctt |
34674274 |
T |
 |
Q |
198 |
ttcaaaaggatccattttatgtcaagcaaccgttactttactcaaaagagcaca |
251 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
T |
34674273 |
ttcaaaaggatccattttgtgtcaagcaaccgttaccttactcaaaagagcaca |
34674220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University