View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0029_high_2 (Length: 321)
Name: NF0029_high_2
Description: NF0029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0029_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 11 - 243
Target Start/End: Original strand, 48183244 - 48183476
Alignment:
| Q |
11 |
aataaatgatgtctaaactctaaacattgatttgaaaaagagagagagataagagtagtagtcgaacaataccgattctgacatgtagcgaccgatgtgg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48183244 |
aataaatgatgtctaaactctaaacattgagttgaaagagagagagagataagagtagtagtcgaacaataccgattctgacatgtagcgaccgatgtgg |
48183343 |
T |
|
| Q |
111 |
tttttgtgcatcctagaaatgtaacacagtgcgtgaagtggcggtggaccacatggtgattggcgtgcgactttacacatagatatcgacattcacgtgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48183344 |
tttttgtgcatcctagaaatgtaacacagtgcgtgaagtggcggtggaccacatggtgattggcatgcgactttacacatagatatcgacattcacgtgg |
48183443 |
T |
|
| Q |
211 |
atttgctccatttcttcccttcctactatgatg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48183444 |
atttgctccatttcttcccttcctactatgatg |
48183476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 793 times since January 2019
Visitors: 1108