View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0029_low_14 (Length: 304)
Name: NF0029_low_14
Description: NF0029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0029_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 144 - 223
Target Start/End: Original strand, 3569147 - 3569226
Alignment:
| Q |
144 |
gaaatgacttcagaacttcctaaaatcacatgacatggggtgataactatgctgagataggaaatttttgttcactttat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3569147 |
gaaatgacttcagaacttcctaaaatcacatgacatggggtgataactatgctgagataggaaatttttgttcactttat |
3569226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 144 - 181
Target Start/End: Original strand, 22027323 - 22027360
Alignment:
| Q |
144 |
gaaatgacttcagaacttcctaaaatcacatgacatgg |
181 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
22027323 |
gaaatgacttcagaatttcctaaaatcacatgatatgg |
22027360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 144 - 181
Target Start/End: Original strand, 42104194 - 42104231
Alignment:
| Q |
144 |
gaaatgacttcagaacttcctaaaatcacatgacatgg |
181 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
42104194 |
gaaatgacttcagaatttcctaaaatcacatgatatgg |
42104231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 795 times since January 2019
Visitors: 1108